View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_low_11 (Length: 366)
Name: NF10919_low_11
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 153 - 323
Target Start/End: Original strand, 28447982 - 28448152
Alignment:
| Q |
153 |
tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28447982 |
tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt |
28448081 |
T |
 |
| Q |
253 |
ctatttctataggcgtcaggcctacagacctcccctctacatcgatgatgatggatgctagtggggccggg |
323 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28448082 |
ctatttctataggcatcagacctacagacctcccctctacatcgatgatgatggatgctagtggggccggg |
28448152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 156 - 233
Target Start/End: Original strand, 18690607 - 18690684
Alignment:
| Q |
156 |
gggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaat |
233 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
18690607 |
gggctttggttggccttggcttcggtgttcctctctctgaggttcctagtttttgcgttggaagttacaaccttcaat |
18690684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University