View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_low_14 (Length: 334)
Name: NF10919_low_14
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 308
Target Start/End: Complemental strand, 53700666 - 53700378
Alignment:
| Q |
11 |
cacagacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtggaaaaaattataatctagtac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700666 |
cacacacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtggaaaaaattataatctagtac |
53700567 |
T |
|
| Q |
111 |
aagatataatagatatttaaggaaattgagtttagatgtggagagctgccattgtatgggcttgggctgtacacaaagaaaggataggaaaaactgttgt |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700566 |
aagat---atagatatttaaggaaattgagtttagatgtggagagctgccattgta------tgggctgtacacaaagaaaggataggaaaaactgttgt |
53700476 |
T |
|
| Q |
211 |
tatgtgtatgatgcgaccagaatgcaccatggaactgttcctcgtgccactatactactaatttcaatatactttattgctcttattaattttatggg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700475 |
tatgtgtatgatgcgaccagaatgcaccatggaactgttcctcgtgccactatactactaatttcaatatactttattgctcttattaattttatggg |
53700378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University