View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_low_18 (Length: 250)
Name: NF10919_low_18
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 3 - 240
Target Start/End: Complemental strand, 38901990 - 38901769
Alignment:
| Q |
3 |
gtctcgtctctttatgtaattaattattaatcatgcagaattatactattaactttgtttgcaatctgcgatgtttggaagacaaggcatctcttatgaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38901990 |
gtctcgtctctttatgtaattaattattaatcatgcaaaattatactattaactttgtctgcaatctgcgatgtttggaagacaaggcatctcttatgca |
38901891 |
T |
|
| Q |
103 |
ttttcttttgcaagtgaattctgttgcacatatgatattatgatttgtgcaatcaacatatctttcgcggtttcaagataaccatgctatgcaattaatt |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38901890 |
ttttcttttgca----------------catatgatattatgatttgtgcaatcaacatatctttcgcggtttcaagataaccatgctatgcaattaatt |
38901807 |
T |
|
| Q |
203 |
tgtgtttgtcaaaagagtcgttttttgcgtgttctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38901806 |
tgtgtttgtcaaaagagtcgttttttgtgtgttctctg |
38901769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University