View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10919_low_18 (Length: 250)

Name: NF10919_low_18
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10919_low_18
NF10919_low_18
[»] chr7 (1 HSPs)
chr7 (3-240)||(38901769-38901990)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 3 - 240
Target Start/End: Complemental strand, 38901990 - 38901769
Alignment:
3 gtctcgtctctttatgtaattaattattaatcatgcagaattatactattaactttgtttgcaatctgcgatgtttggaagacaaggcatctcttatgaa 102  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |    
38901990 gtctcgtctctttatgtaattaattattaatcatgcaaaattatactattaactttgtctgcaatctgcgatgtttggaagacaaggcatctcttatgca 38901891  T
103 ttttcttttgcaagtgaattctgttgcacatatgatattatgatttgtgcaatcaacatatctttcgcggtttcaagataaccatgctatgcaattaatt 202  Q
    ||||||||||||                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38901890 ttttcttttgca----------------catatgatattatgatttgtgcaatcaacatatctttcgcggtttcaagataaccatgctatgcaattaatt 38901807  T
203 tgtgtttgtcaaaagagtcgttttttgcgtgttctctg 240  Q
    ||||||||||||||||||||||||||| ||||||||||    
38901806 tgtgtttgtcaaaagagtcgttttttgtgtgttctctg 38901769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University