View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_low_21 (Length: 238)
Name: NF10919_low_21
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 38 - 219
Target Start/End: Original strand, 2497607 - 2497788
Alignment:
| Q |
38 |
gccaaagttaaactataatttgaaaactgctttataggccctctctattgctcacaagcctccaaaatgacttcgttttaaacagtcagaaggttcgaac |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2497607 |
gccaaagttaaactataatttgaaaactgctttataggccctctctattgctcacaagcctccaaaatgacttcgttttaaacagtcagaaggttcgaac |
2497706 |
T |
 |
| Q |
138 |
cgatcacctagaaagataactttcgatggatataaatatagaaaaaacatggatcaggtgtttatacaacttttaggtacat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2497707 |
cgatcacctagaaagataactttcgatggatataaatatagaaaaaacatggatcaggtgtttatacaacttttaggtacat |
2497788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University