View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_low_8 (Length: 440)
Name: NF10919_low_8
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 144 - 435
Target Start/End: Complemental strand, 50141723 - 50141435
Alignment:
| Q |
144 |
tcatattcaatgacacaattctttccaaaagaagcttatattcatagacatataaattttagaaatcactttgataaagtgtgattcttaattttccacc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141723 |
tcatattcaatgacacaattctttccaaaagaagcttatattcatagacatataaattttagaaatcactttgataaagtgtgattcttaattttccacc |
50141624 |
T |
|
| Q |
244 |
caaaaaatttttgattcttcttaattggtgatgttgttggtcctcttcttttcgtacacatatgttccttgctatggaattattttgtagagaaaaaggg |
343 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141623 |
caaaaaaaatgtga---ttcttaattggtgatgttgttggtcctcttcttttcgtacacatatgttccttgctatggaattattttgtagagaaaaaggg |
50141527 |
T |
|
| Q |
344 |
tccttttccatttaccccccaaccccacgcatccaacagcaataatattcccatcaatcaatatttgtccatgaactcgtgtctctgcttct |
435 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
50141526 |
tccttttctatttaccccccaaccccacgcatccaacagcaataatattcccatcaatcaatatttctccatgaactcgtgtctatgcttct |
50141435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 43 - 82
Target Start/End: Complemental strand, 50141824 - 50141785
Alignment:
| Q |
43 |
tttaactaagattattcatgacacttaataaggggttatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141824 |
tttaactaagattattcatgacacttaataaggggttatt |
50141785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 50142041 - 50142012
Alignment:
| Q |
18 |
aaaaatgattttgcttttgatcatctttaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50142041 |
aaaaatgattttgcttttgatcatctttaa |
50142012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University