View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10920_high_4 (Length: 377)
Name: NF10920_high_4
Description: NF10920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10920_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 185 - 357
Target Start/End: Original strand, 14431097 - 14431269
Alignment:
| Q |
185 |
gttttcgtccccagagctttgactttttcgccgaatttgtaagagaggtttaagttccctttagctttccccgaagacgttctaacctgataattaacca |
284 |
Q |
| |
|
|||||| || || |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
14431097 |
gttttcatcgccggagcttggactttttcgccgaatttgtaagagaggtttaagtttcctttagctttccctgaagatgttctaacctgataattaacct |
14431196 |
T |
|
| Q |
285 |
gccggaaagaatctccggaggtgttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc |
357 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14431197 |
gccggaaagaatctccggaggggttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc |
14431269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 79 - 185
Target Start/End: Original strand, 14430946 - 14431052
Alignment:
| Q |
79 |
tggatatccataaaccggttgttgcagctgaggaggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagcc |
178 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14430946 |
tggatatccataacccggttgttgcggctgaggaggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagcc |
14431045 |
T |
|
| Q |
179 |
atcaccg |
185 |
Q |
| |
|
||||||| |
|
|
| T |
14431046 |
atcaccg |
14431052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 103
Target Start/End: Original strand, 14430734 - 14430775
Alignment:
| Q |
62 |
ttctgtgcttctgccactggatatccataaaccggttgttgc |
103 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
14430734 |
ttctgtgcttgtgcccctggatatccataacccggttgttgc |
14430775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University