View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10920_low_5 (Length: 370)
Name: NF10920_low_5
Description: NF10920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10920_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 216 - 329
Target Start/End: Original strand, 20248673 - 20248787
Alignment:
| Q |
216 |
gtctaccttttcttctggatacaccatccttcttttttatacccataacttcatatgcattgaagttttcatttaaagcaattgttctgtcatcagggtt |
315 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
20248673 |
gtctaccttttcctctggatacaccatccttcttttttatacccataacttcagatgcattgaagttttcattcaaagcaattgttctgtcatcagagtt |
20248772 |
T |
|
| Q |
316 |
-acatcatttgtttg |
329 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
20248773 |
aacataatttgtttg |
20248787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 331 - 370
Target Start/End: Original strand, 23881376 - 23881415
Alignment:
| Q |
331 |
cagcatagagtacaatcttttataacatatgagatttcaa |
370 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23881376 |
cagcatagagtacaaacttttataacagatgagatttcaa |
23881415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University