View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10921_high_1 (Length: 714)

Name: NF10921_high_1
Description: NF10921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10921_high_1
NF10921_high_1
[»] chr6 (1 HSPs)
chr6 (546-606)||(34900120-34900180)


Alignment Details
Target: chr6 (Bit Score: 53; Significance: 5e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 546 - 606
Target Start/End: Complemental strand, 34900180 - 34900120
Alignment:
546 aaaactatggtggtgcattactttaataaattttatatttgaaattttgttcttcatgtac 606  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||    
34900180 aaaactatggtggtgcaatacttcaataaattttatatttgaaattttgttcttcatgtac 34900120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University