View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10922_high_9 (Length: 255)
Name: NF10922_high_9
Description: NF10922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10922_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 41306047 - 41306284
Alignment:
| Q |
1 |
ttcgtcttcattttatcaaaggcacattctctttcacgttctaagtaacttttgcagcaattgcattgcctgtactttgctactcatattatctagtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41306047 |
ttcgtcttcattttatcaaaggcacattctctttcatgttctaagtaacttttgcagcaattgcattgcctatactttgctactcatattatctagtatg |
41306146 |
T |
|
| Q |
101 |
ctaaaagtaaaccagatgtgtaatgtaaacagatatcttatgggagattctcaaggaaaaatagaggaaaatgtgagattgacttgttaatcattcaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41306147 |
ctaaaagtaaaccagatgtgtaatgtaaacagatatcttatgggagattctcaaggaaaaatagaggaaaatctgagattgacttgttaatcattcaagg |
41306246 |
T |
|
| Q |
201 |
caaaaatctttgtcattgcgtcttaagatgggattact |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41306247 |
caaaaatctttgtcattgcgtcttaagatggaattact |
41306284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 84 - 199
Target Start/End: Original strand, 41301439 - 41301554
Alignment:
| Q |
84 |
tcatattatctagtatgctaaaagtaaaccagatgtgtaatgtaaacagatatcttatgggagattctcaaggaaaaatagaggaaaatgtgagattgac |
183 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
41301439 |
tcatcttatctagtatgctaaaagtaaaccaaatgtgtcatgtaaacagatatcttatgggagattctcaaagaaacctagaggaaaatgtgagattgac |
41301538 |
T |
|
| Q |
184 |
ttgttaatcattcaag |
199 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
41301539 |
ttgttcatcatgcaag |
41301554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University