View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10922_low_15 (Length: 243)
Name: NF10922_low_15
Description: NF10922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10922_low_15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 18270554 - 18270318
Alignment:
| Q |
6 |
atggacatcactgtttttgatacaggaaaccctatagattttatccaagtaccaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270554 |
atggacatcactgtttttgatacaggaaaccctatagattttatccaagtatcaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaa |
18270455 |
T |
|
| Q |
106 |
tgcaccccccacatcacacagagagggagaaggttcattttttacttcacggggttgaaagaaagattttatcatggccttgcacccacttgcaaagagg |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18270454 |
tgcaccccccacatcacacagaga-ggagaaggttcattttttacttcacggggttgaaagaaagattttatcatgcccttgcacccacttgcaaagagg |
18270356 |
T |
|
| Q |
206 |
tcttcaccagctgagcttttcaacatcttacatcgctc |
243 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18270355 |
tcttcaccagctgagcttgtcaacatcttacatcgctc |
18270318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University