View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10922_low_9 (Length: 282)
Name: NF10922_low_9
Description: NF10922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10922_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 44801722 - 44801453
Alignment:
| Q |
1 |
tcacaactcatgtaggttttaggaataaagaaaatctagcgtcaaggaaatgtctacggctataagttgattagaatatgaactagtgaaccggacaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44801722 |
tcacaactcatgtaggttttaggaagaaagaaaatctagtgtcaaggaaatgtctacggctataagttgattaga---tgaactagtgaaccggacaaac |
44801626 |
T |
 |
| Q |
101 |
taaaccaatctaatatgtaaaatacaacgagcactatgcaaatagnnnnnnnaattaaattgtagtaaaatttatgtcttacatatgtgatggtnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801625 |
taaaccaatctaatatgtaaaatacaacgagcactatgcaaatagtttttttaattaaattgtagtaaaatttatgtcttacatatgtgatggtaaaaaa |
44801526 |
T |
 |
| Q |
201 |
nngtccactttcacacggtccctttcataagaaaccatctctctcaaacacttagaaaccctaactttcatct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801525 |
aagtccactttcacacggtccctttcataagaaaccatctctctcaaacacttagaaaccctaactttcatct |
44801453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University