View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_30 (Length: 364)
Name: NF10923_high_30
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 353
Target Start/End: Complemental strand, 38096509 - 38096157
Alignment:
| Q |
1 |
ctgctgctttgctttcatctctgcacctgaacttccacacgctatcagctgcagcaaaacagagtaacgactcgacgtagtcgatggtgccgacgtcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096509 |
ctgctgctttgctttcatctctgcacctgaacttccacacgctatcagctgcagcaaaacagagtaacgactcgacgtagtcgatggtgccgacgtcgtt |
38096410 |
T |
 |
| Q |
101 |
ggatagttactatctttgacattgttgacccttctttcttctctttgtttcagtttctcagcaagggtagtagtggaatttgttgtaggannnnnnnnnn |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38096409 |
ggatagttattatctttgacattgttgacccttctttcttctctttgtttcagtttctcagcaagggtagtagtggaatttgttgtagaaggtggtggtg |
38096310 |
T |
 |
| Q |
201 |
nnnnnnnnnnnntagttataactatctcatcaagttcttctgttgaaacacctcttgagcaacgagaatgaggtgttgttgttgaacttgtgtaacttgt |
300 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096309 |
gttgtggtgggttagttataactatctcgtcgagttcttctgttgaaacacctcttgagcaacgagaatgaggtgttgttgttgaacttgtgtaacttgt |
38096210 |
T |
 |
| Q |
301 |
tttctctccatctcctaataattcctcttcatattcttcatattgatcttcat |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096209 |
tttctctccatctcctaataattcctcttcatattcttcatattgatcttcat |
38096157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University