View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_46 (Length: 297)
Name: NF10923_high_46
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 23321015 - 23321111
Alignment:
| Q |
20 |
ggatttgctacacagcttgaaaaacatggtgcttttatcaatgatcctctttggagtgctatttgtttgatcaaacagccacatcttattaagaagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23321015 |
ggatttgctacacagcttgaaaaacatggtgcttttatcaatgatcctctttggagtgctatttgtttgatcaaacagccacatcttattaagaagg |
23321111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 198 - 280
Target Start/End: Original strand, 23321209 - 23321291
Alignment:
| Q |
198 |
gacatgccttcgactcaacagacacacgtgattgcattgaattatgtgattttctaagatcattaatggtgtcggcttgtcat |
280 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23321209 |
gacatgccttcgactcaacagacacatgtgattgcattgaattatgtgattttctaagattattaatggtgtcggcttgtcat |
23321291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 43942374 - 43942324
Alignment:
| Q |
220 |
cacacgtgattgcattgaattatgtgattttctaagatcattaatggtgtc |
270 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| | ||||||| ||||||| |
|
|
| T |
43942374 |
cacacgtgattacattgaattatgttattttctcaaatcattattggtgtc |
43942324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 4786362 - 4786406
Alignment:
| Q |
235 |
tgaattatgtgattttctaagatcattaatggtgtcggcttgtca |
279 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||| ||||| |
|
|
| T |
4786362 |
tgaattatgtgattttcttaaattattaatggtgtcggcgtgtca |
4786406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University