View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_56 (Length: 250)
Name: NF10923_high_56
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 18345510 - 18345741
Alignment:
| Q |
1 |
atctgcatggacgtagatgttgaagaggtggttgtttccaacgaagaatttttcccataaaggagcgaaggtgaggttagagttggtgaggaagaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18345510 |
atctgcatggacgtagatgttgaagaggtggttgtttccaacgaagaatttttcccataaaggagcgaaggtgaggttagagttggtgaggaagaggaaa |
18345609 |
T |
|
| Q |
101 |
gcgattttgggtttgggttttatgagggtgaaaatnnnnnnnnnnnnnnnnnnnnnnncgcggcggaagagggtgaggtcgttggcgtcgggggaggaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18345610 |
gcgattttgggtttgggttttatgagggtgaaaatgtgggtggtggtgtgggtggtggcgcggcggaagagggtgaggtcgttggcgtcgggggaggaga |
18345709 |
T |
|
| Q |
201 |
aagggaaggagaattgagagaggtgttgttgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18345710 |
aagggaaggagaattgagagaggtgttgttgg |
18345741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 18340353 - 18340466
Alignment:
| Q |
2 |
tctgcatggacgtagatgttgaagaggtggttgtttccaacgaagaatttttccc-ataaaggagcgaaggtgaggttagagttggtgaggaagaggaaa |
100 |
Q |
| |
|
|||||||||| ||| || |||||||| ||||||||||| |||||||||||||| |||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
18340353 |
tctgcatggatgtatatattgaagagatggttgtttccggtgaagaatttttccccataaaggagcaaaggtgaggttggtgttggtgaggaagaggaaa |
18340452 |
T |
|
| Q |
101 |
gcgattttgggttt |
114 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
18340453 |
gcgattttaggttt |
18340466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 2 - 114
Target Start/End: Complemental strand, 18303349 - 18303237
Alignment:
| Q |
2 |
tctgcatggacgtagatgttgaagaggtggttgtttccaacgaagaatttttcccataaaggagcgaaggtgaggttagagttggtgaggaagaggaaag |
101 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||| |||||| ||||||| |||||||| ||||||| ||| | ||| |||||||||||||| | |
|
|
| T |
18303349 |
tctgcgtggatgtagatgttgaagaggtggttgtttccagtaaagaatatttcccacaaaggagcaaaggtgaagttggtgtttgtgaggaagaggaagg |
18303250 |
T |
|
| Q |
102 |
cgattttgggttt |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
18303249 |
cgattttgggttt |
18303237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University