View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_60 (Length: 238)
Name: NF10923_high_60
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 115 - 228
Target Start/End: Complemental strand, 42693438 - 42693326
Alignment:
| Q |
115 |
tttttgtcatttgaaattcaaagtatttgggaatttttagttgaaatattggactaccaatttcaagcttaacttgtaaatcaagctgtaatgaagtcaa |
214 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42693438 |
tttttgtcattcgaa-ttcgaagtatttgggaatttctagttgaaatattggactaccaatttcaagcttaacttgtaaatcaagctgtaatgaagtcaa |
42693340 |
T |
 |
| Q |
215 |
tgtcttcatctcac |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42693339 |
tgtcttcatctcac |
42693326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 42693713 - 42693674
Alignment:
| Q |
18 |
attctaatactaacaagagtgttaatagaaaatgctcttg |
57 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42693713 |
attctaatattaacaagagtgttaatagaaaatgctcttg |
42693674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University