View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10923_high_62 (Length: 237)

Name: NF10923_high_62
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10923_high_62
NF10923_high_62
[»] chr7 (1 HSPs)
chr7 (16-219)||(1252167-1252369)


Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 1252369 - 1252167
Alignment:
16 agggaaacgatcccatcacataaaaagccacaccgcatgctctattattgatgacttcttaacacaaagtgcgacaaaccaaggaatgataaagagtacg 115  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||| || ||||||||||||||||||    
1252369 agggaaaccatcccatcacataaaaagccacaccgcatgctctattattgatgacttctgaacacaa-gtgcaacaaaacatggaatgataaagagtacg 1252271  T
116 aatccctgatctcttttgatctttgaactctgcacaaattgagcaagaaataaatgggagtaagtatggttgcccatacagttgacataaacatacatga 215  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1252270 aatcactgatctcttttgatctttgaactctgcccaaattgagcaagaaataaatgggagtaagtatggttgcccatacagttgacataaacatacatga 1252171  T
216 ctat 219  Q
    ||||    
1252170 ctat 1252167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University