View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_62 (Length: 237)
Name: NF10923_high_62
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 1252369 - 1252167
Alignment:
| Q |
16 |
agggaaacgatcccatcacataaaaagccacaccgcatgctctattattgatgacttcttaacacaaagtgcgacaaaccaaggaatgataaagagtacg |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||| || |||||||||||||||||| |
|
|
| T |
1252369 |
agggaaaccatcccatcacataaaaagccacaccgcatgctctattattgatgacttctgaacacaa-gtgcaacaaaacatggaatgataaagagtacg |
1252271 |
T |
 |
| Q |
116 |
aatccctgatctcttttgatctttgaactctgcacaaattgagcaagaaataaatgggagtaagtatggttgcccatacagttgacataaacatacatga |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252270 |
aatcactgatctcttttgatctttgaactctgcccaaattgagcaagaaataaatgggagtaagtatggttgcccatacagttgacataaacatacatga |
1252171 |
T |
 |
| Q |
216 |
ctat |
219 |
Q |
| |
|
|||| |
|
|
| T |
1252170 |
ctat |
1252167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University