View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_65 (Length: 234)
Name: NF10923_high_65
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_65 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 36821264 - 36821497
Alignment:
| Q |
1 |
taatatgagaaaatgaattgattgcatttgcatgtaatcacacctgtcggtgtattgtcgatgtcggacagtggcacatgtcagacaccggacacacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36821264 |
taatatgagaaaatgaattgattgcatttgcatgtaatcacacctgtcagtgtattgtcgatgtcagacagtggcacatgtcagacaccggacacacatt |
36821363 |
T |
|
| Q |
101 |
cgatcagaggtggtactacagagtttagtatagagttcaatggtgactaatgtatgatatttcattgaaattagtgtatttgaaattagctatcaaatgc |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36821364 |
cgatcagaggtggtactacatagtttagtatagagttcaatggtgactaatgtatgatatttcattgaaattagtgtatttgaaattagctatcaaatgc |
36821463 |
T |
|
| Q |
201 |
tatgaagcaccagcagagacaccgaacacgacac |
234 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |
|
|
| T |
36821464 |
tatgaagcaccagcatagacaccgtacacgacac |
36821497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 112
Target Start/End: Original strand, 15083856 - 15083890
Alignment:
| Q |
78 |
atgtcagacaccggacacacattcgatcagaggtg |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
15083856 |
atgtcagacaccggacacaccttcgatcagaggtg |
15083890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 106
Target Start/End: Complemental strand, 540833 - 540783
Alignment:
| Q |
56 |
tgtcgatgtcggacagtggcacatgtcagacaccggacacacattcgatca |
106 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||| |||| |
|
|
| T |
540833 |
tgtcgatgtcggacatggacacatgtcagacaccggacacaccttccatca |
540783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University