View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_high_68 (Length: 221)
Name: NF10923_high_68
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_high_68 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 53303 - 53100
Alignment:
| Q |
18 |
ttaggaatgttattaaccagactccacacccgccatgttttcacaatacgttcacccacctctaattaattatgtatgattgtttgctaaaatattcgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53303 |
ttaggaatgttattaaccagactccacacccgctatgttttcacaataagttcacccacctctaattaattatgtatgattgtttgctaaaatattcgga |
53204 |
T |
 |
| Q |
118 |
aatcttcgcattgaaccaaagacaatcaaacaaacgacttagacaatacatcttcatcaaaaatcttaatgtgttgtgctgggtatatgtgccttctcga |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53203 |
aatcttcgcattgaaccaaagataatcaaacaaacgacttacacaatacatcttcatcaaaaatcttaatatgttgtgctgggtatatgtgccttctcga |
53104 |
T |
 |
| Q |
218 |
ttat |
221 |
Q |
| |
|
|||| |
|
|
| T |
53103 |
ttat |
53100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University