View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_38 (Length: 344)
Name: NF10923_low_38
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 130 - 324
Target Start/End: Original strand, 10258066 - 10258260
Alignment:
| Q |
130 |
aaatttggaaaatgatgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258066 |
aaatttggaaaatgatgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaac |
10258165 |
T |
 |
| Q |
230 |
tcatgttatagttggaaaatctcaaggtcttattagaccaactatttctttacctaggtattgtgctaagaagctatcaaaggattgttgggttt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258166 |
tcatgttatagttggaaaatctcaaggtcttattagaccaactatttctttacctaggtattgtgctaagaagctatcaaaggattgttgggttt |
10258260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 28 - 104
Target Start/End: Original strand, 10257968 - 10258041
Alignment:
| Q |
28 |
gactttactttctgagaatcagagggttaataatagacaaaagttaatttaaagaaatatgtatgtatcaagtgcca |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10257968 |
gactttactttctgagaatcagaaggttaat---agacaaaagttaatttaaagaaatatgtatgtatcaagtgcca |
10258041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 246
Target Start/End: Original strand, 40376548 - 40376649
Alignment:
| Q |
145 |
tgtaggtggatctgaagctaaaaatttgccggggttcgtcagtgaggagaattttggttagagaagcaaatgaatattgtgcaactcatgttatagttgg |
244 |
Q |
| |
|
||||||||||||| || |||||||||||||| || || || |||| |||||||||||| |||||||||||| |||| |||| |||||||||| ||||| |
|
|
| T |
40376548 |
tgtaggtggatcttaaactaaaaatttgccgtggatcatcggtgaagagaattttggtacgagaagcaaatgcttattctgcatctcatgttattgttgg |
40376647 |
T |
 |
| Q |
245 |
aa |
246 |
Q |
| |
|
|| |
|
|
| T |
40376648 |
aa |
40376649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University