View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_49 (Length: 306)
Name: NF10923_low_49
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 79 - 287
Target Start/End: Original strand, 26111735 - 26111931
Alignment:
| Q |
79 |
aagatgcaagatggattcatgaacaactactggatagtttttgcattaatttcattgaagaagtttagcttagtgactggttatcccatctatttcagga |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26111735 |
aagatgcaagatggattcatgaacaactactggatagattttgcattaatttcattgaagaagtttagcttagtgactggttatcccatctatttcagga |
26111834 |
T |
|
| Q |
179 |
tgcccaaaaaatcaatacaagaaactaccaattttgttttgttgattgttttgaggagacaatcttaccatgtaagggaactgtgttttaccacccatct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26111835 |
tgcccaaaaaatcaatacaagaaactaccaatt------------ttgttttgaggagacaatcttaccatgtaagggaactgtgttttaccacccatct |
26111922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 26111703 - 26111737
Alignment:
| Q |
1 |
tatttaataaccatcacaaggtgtgataagcaaag |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26111703 |
tatttaataaccatcacaaggtgtgataagcaaag |
26111737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University