View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_53 (Length: 291)
Name: NF10923_low_53
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 19 - 147
Target Start/End: Complemental strand, 51190549 - 51190421
Alignment:
| Q |
19 |
gcaggtatatggttgaagaaagtgacatcagaaacttcaccttttcattcagctcaagattcttaagagtcccttcaaatttaagtgaagatccaaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190549 |
gcaggtatatggttgaagaaagtgacatcagaaacttcaccttttcattcagctcaagattcttaagagtcccttcaaatttaagtgaagatccaaatct |
51190450 |
T |
|
| Q |
119 |
tgaaatctttattcagagacaaccatcac |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51190449 |
tgaaatctttattcagagacaaccatcac |
51190421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 177 - 282
Target Start/End: Complemental strand, 51190385 - 51190280
Alignment:
| Q |
177 |
catgaacttgttcttcttgatcatgaagaaggtggaagcagcaatgttacaaagtggaagcaagaacaacctttgcatatgattaatcataaaatattga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51190385 |
catgaacttgttcttcttgatcatgaagaaggtggaagcagcaatgttacaaagtggaagcaagaacaaactttgcatatgattaatcataaaatattga |
51190286 |
T |
|
| Q |
277 |
tctctg |
282 |
Q |
| |
|
|||||| |
|
|
| T |
51190285 |
tctctg |
51190280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University