View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_60 (Length: 256)
Name: NF10923_low_60
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 2 - 249
Target Start/End: Original strand, 40195500 - 40195747
Alignment:
| Q |
2 |
aaattcttctgatcttgtatttggcattgaaaattcgaatttattgttatttgtttactaaattgaaagctatgtttggcatcactctgaattttcaaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40195500 |
aaattcttctgatcttgtatttggcattgaaaattcgaatttattgttatttgtttactaaattgaaagctatgtttggcatcactctgaattttcaaaa |
40195599 |
T |
 |
| Q |
102 |
tccatactccgtaactttcacgaaatcaagatgtgattatggcaaactcaccctgataccaaacaagtacttagtattttggatctgattatgctattgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40195600 |
tccatactccgtaactttcacgaaatcaagatgtgattatggcaaactcaccctgataccaaacaagtacttagtattttgtatctgattatgctattgt |
40195699 |
T |
 |
| Q |
202 |
tcatattggtaggtgttggtaaaagttgtcttttattgcgtttctctg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40195700 |
tcatattggtaggtgttggtaaaagttgtcttttattgcgtttctctg |
40195747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University