View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_62 (Length: 253)
Name: NF10923_low_62
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 36640896 - 36640666
Alignment:
| Q |
12 |
atgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36640896 |
atgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgctagttt |
36640799 |
T |
|
| Q |
112 |
gcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640798 |
gcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtg |
36640699 |
T |
|
| Q |
212 |
tttagctgataggtgggattgtgttgctgatgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36640698 |
tttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 36633530 - 36633302
Alignment:
| Q |
12 |
atgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36633530 |
atgaactcatttgcagatgctttagcaaaaagtggcgtgaatatggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgctagttt |
36633431 |
T |
|
| Q |
112 |
gcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36633430 |
gcaattcaaaatttattttacagaaatagagaaatctatttgtatatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtggggtgtg |
36633331 |
T |
|
| Q |
212 |
tttagctgataggtgggattgtgttgctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36633330 |
tttagctgataggtgggattgtgttgctg |
36633302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University