View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_65 (Length: 244)
Name: NF10923_low_65
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 49446346 - 49446130
Alignment:
| Q |
21 |
atcattggctttccccatgtcgtcaaatgggtcaaccatgttgtacaaagcggagttgagaccattgatctccttgtggatactatgtttggtggtggtc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446346 |
atcattggctttccccatgtcgtcaaatgggtcaaccatgttgtacaaagcggagttgagaccattgatctccttgtggatactatgtttggtggtggtc |
49446247 |
T |
 |
| Q |
121 |
ctaaattgcctattagcattctcagctgcaagactcttgttgttctcaaatttcagcgtttctctgtgaagggctttacttccattagacttccctgcct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49446246 |
ctaaattgcctattagcattctcagctgcaagactcttgttgttctcaaatttcagcgtttctctgtgaagggctttacttccattagacttccctgcct |
49446147 |
T |
 |
| Q |
221 |
caaaatccttcatctca |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49446146 |
caaaatccttcatctca |
49446130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 231
Target Start/End: Complemental strand, 17642192 - 17642084
Alignment:
| Q |
123 |
aaattgcctattagcattctcagctgcaagactcttgttgttctcaaatttcagcgtttctctgtgaagggctttacttccattagacttccctgcctca |
222 |
Q |
| |
|
||||||| | |||||||||| | ||||| |||||||||||||||| | ||| | | ||| |||||||||| ||| ||| | ||||||| | || ||||| |
|
|
| T |
17642192 |
aaattgcttgttagcattctaacctgcaggactcttgttgttctcgagttttatgggttcgctgtgaaggggttttctttctttagactcctctccctca |
17642093 |
T |
 |
| Q |
223 |
aaatccttc |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
17642092 |
aaatccttc |
17642084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University