View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10923_low_66 (Length: 238)
Name: NF10923_low_66
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10923_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 45324744 - 45324537
Alignment:
| Q |
15 |
cacagatacgaatgagtctctaagtgaaagattagaaaggattatgagagtgttataaaataatatatattgaaaaatgattttgtcgtcaaactaaatt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45324744 |
cacacatacgaatgagtctctaagtgaaagattagaaaggattatgagagtgttataaaataatatatattgaaaaatgattttgtcgtcaaattaaatt |
45324645 |
T |
 |
| Q |
115 |
gggatgagacgggtaactcaaactcagtcattgtttaatttgtatccctgttttatcgtcccttgttttttaccatgttaaaattttttgttgaggatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45324644 |
gggatgagacgggtaactcaaactcagtcattgtttaagttgtatccctgtcttatcgtcccttgttttttaccatgttaaaattttttgttgaggatta |
45324545 |
T |
 |
| Q |
215 |
atgtataa |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
45324544 |
atgtataa |
45324537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University