View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10923_low_74 (Length: 224)

Name: NF10923_low_74
Description: NF10923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10923_low_74
NF10923_low_74
[»] chr1 (1 HSPs)
chr1 (1-205)||(39269715-39269919)


Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 39269919 - 39269715
Alignment:
1 gcattctgcaagagcgagacaactttggccgcggtttcagagaaactgggtaagcttttggatgttgaagggaaacttgcactatattaaattgacagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
39269919 gcattctgcaagagcgagacaactttggccgcggtttcagagaaactgggtaagcttttggatgttgaagggaaacttgcgctatattaaattgacagaa 39269820  T
101 agaatgatggtgatggagcagctatgaagattgaggatacaatgttttgtttgaattaataaagtttgttatatggttaatttgaccaagagaagactat 200  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39269819 agaataatggtgatggagcagctatgaagattgaggatacaatgttttgtttgaattaataaagtttgttatatggttaatttgaccaagagaagactat 39269720  T
201 gtgaa 205  Q
    |||||    
39269719 gtgaa 39269715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University