View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10924_low_1 (Length: 426)
Name: NF10924_low_1
Description: NF10924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10924_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 99 - 408
Target Start/End: Original strand, 735616 - 735925
Alignment:
| Q |
99 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735616 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
735715 |
T |
|
| Q |
199 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735716 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
735815 |
T |
|
| Q |
299 |
actcaaatgtgaaatccttgatccctgcgaaaaccatttttcaaagaagagagaatctccctctggtgataaagaaaatcttacaccagtttcacagtcc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735816 |
actcaaatgtgaaatccttgatccctgcgaaaaccatttttcaaagaagagagaatctccctttggtgataaagaaaatcttacaccagtttcacagtcc |
735915 |
T |
|
| Q |
399 |
aagtccttat |
408 |
Q |
| |
|
|||||||||| |
|
|
| T |
735916 |
aagtccttat |
735925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 735540 - 735600
Alignment:
| Q |
14 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735540 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
735600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 63
Target Start/End: Original strand, 732389 - 732438
Alignment:
| Q |
14 |
agcagagaagctagtttccgtcataggtcactggctaccgttcccgttcc |
63 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| | ||||| ||||||| |
|
|
| T |
732389 |
agcagagaagctagtttccgtaataggtcattggtttccgttaccgttcc |
732438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University