View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10924_low_4 (Length: 241)
Name: NF10924_low_4
Description: NF10924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10924_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 45466436 - 45466643
Alignment:
| Q |
15 |
ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattctttttattgatgagattcatcttgttct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45466436 |
ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattcttttcattgatgagattcatcttgttct |
45466535 |
T |
 |
| Q |
115 |
tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45466536 |
tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag |
45466635 |
T |
 |
| Q |
215 |
gagtatag |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
45466636 |
gagtatag |
45466643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 10044324 - 10044531
Alignment:
| Q |
15 |
ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattctttttattgatgagattcatcttgttct |
114 |
Q |
| |
|
|||||||| |||||||| | ||||||||||| |||||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
10044324 |
ataggggacaatttgaacaaaggttgaaggcagttttgaaagaagtggaagatgctgaagggaaggttattgttttcattgatgaaattcatcttgttct |
10044423 |
T |
 |
| Q |
115 |
tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag |
214 |
Q |
| |
|
|| || ||| | |||||||||||||||||||||||||||| || || |||||||||||||| || ||| |||| || ||||| ||||||||||| |
|
|
| T |
10044424 |
cggtgccggtcaatgtcaaggatcaatggatgctgctaatcttttgaaacctatgcttgctcgtggccaacttagatgcatcggtgcaacaacacttgat |
10044523 |
T |
 |
| Q |
215 |
gagtatag |
222 |
Q |
| |
|
|| ||||| |
|
|
| T |
10044524 |
gaatatag |
10044531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University