View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10924_low_7 (Length: 225)
Name: NF10924_low_7
Description: NF10924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10924_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 90 - 207
Target Start/End: Complemental strand, 34772023 - 34771906
Alignment:
| Q |
90 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772023 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
34771924 |
T |
|
| Q |
190 |
acaagcaggtcatctcat |
207 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34771923 |
acaagcaggtcatctcat |
34771906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University