View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_high_20 (Length: 258)
Name: NF10925_high_20
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 46531114 - 46531339
Alignment:
| Q |
10 |
gcacagaggatttcaaccgcagcactcttctactttcacaattgnnnnnnncaagaagaagaatgagttaccaccgcgaatcaatcgctaatttaaccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46531114 |
gcacagaggatttcaaccgcagcactcttctactttcacaattgaaaaaaaccagaagaagaatgagttaccaccgcgaatcaatcgctaatttaaccaa |
46531213 |
T |
 |
| Q |
110 |
gaatgctatgaacatcaccaaacatttggtatcaaaaacagaattcaagaagaagaatgtcgtgctttcaccgttgtcactccaaactgtgctcagcata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46531214 |
gaatgctatgaacatcaccaaacatttggtatcaaaaacagaattcaagaagaagaatgtcgtgctttcaccgttgtcactccaaactgtgctcagcata |
46531313 |
T |
 |
| Q |
210 |
gtagctgccggttccgagggtccgac |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46531314 |
gtagctgccggttccgagggtccgac |
46531339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University