View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_high_31 (Length: 238)
Name: NF10925_high_31
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 44222710 - 44222503
Alignment:
| Q |
18 |
cctgttttgtgcaagcaatataagcagactcactgcaacacagttgatgatgaagccagttgtactgtaccaatgtcgctttctacaaaagggtttaagt |
117 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44222710 |
cctgttttgtgcaagaaata--agcagactcactgcaacacagttgatgatgaagccagttgtactgtaccaatgtcgctttctacaaaagggtttaagt |
44222613 |
T |
|
| Q |
118 |
ttaacgtacttcacaactcaacagatatagctaggaagaaattgggatctgcttcagcacttccacctcatttccatgtttgtttagtgctttttatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44222612 |
ttaacgtacttcacaactcaacagatatagctaggaagaaattgggatctgcttcatcacttccacctcatttccatgtttgtttagtgctttttatatt |
44222513 |
T |
|
| Q |
218 |
taacttgtgt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
44222512 |
taacttgtgt |
44222503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University