View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_12 (Length: 416)
Name: NF10925_low_12
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 185 - 302
Target Start/End: Complemental strand, 10779538 - 10779421
Alignment:
| Q |
185 |
gacattatttactacgggttataaaagtataattgaaatgacattatctactatgggttagttatagtttcagttgtgcgtcaaagagacaataataaag |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10779538 |
gacattatttactacgggttataaaagtataattaaaatgacattatctactatgggttagttatagtttcagttgtgcgtcaaagagacaataataaag |
10779439 |
T |
 |
| Q |
285 |
tccctaaattattttacg |
302 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10779438 |
tccctaaattattttacg |
10779421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 10779383 - 10779325
Alignment:
| Q |
340 |
ctttcaagggtcactctcgaatctcttatgcttcttaaattttttcacatcgcgtggtc |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
10779383 |
ctttcaagggtcactctcgaatctcttatgcttcttaaatttttttatatcgcgaggtc |
10779325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10779721 - 10779675
Alignment:
| Q |
1 |
acttgttatggttagttacgcctaatagtgatttcaaacaatattcct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10779721 |
acttgttatggttagttacgcctaatagtga-ttcaaacaatattcct |
10779675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University