View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10925_low_16 (Length: 311)

Name: NF10925_low_16
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10925_low_16
NF10925_low_16
[»] chr5 (2 HSPs)
chr5 (18-117)||(3868037-3868136)
chr5 (205-298)||(3878040-3878134)


Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 3868037 - 3868136
Alignment:
18 tttttagtcgtttaattgatgtatacttatataaaaatacttttaattttatcattcattgtttaacaaattattactcactttttaatgcaaagagaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3868037 tttttagtcgtttaattgatgtatacttatataaaaatacttttaattttatcattcattgtttaacaaattattactcactttttaatgcaaagagaat 3868136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 205 - 298
Target Start/End: Original strand, 3878040 - 3878134
Alignment:
205 ttaatagtaaatatacatgtcc-tgtgagctcagctcagttgataagcacatgcattattatagcctcaaaatgtttacaactaccatcttttct 298  Q
    ||||||||||||| |||||||| ||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||    
3878040 ttaatagtaaatacacatgtccctgtaagctcagctcagttgataaggacatgcattattatagcgtcaaaatgtttacaactaccatcttttct 3878134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University