View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_16 (Length: 311)
Name: NF10925_low_16
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 3868037 - 3868136
Alignment:
| Q |
18 |
tttttagtcgtttaattgatgtatacttatataaaaatacttttaattttatcattcattgtttaacaaattattactcactttttaatgcaaagagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3868037 |
tttttagtcgtttaattgatgtatacttatataaaaatacttttaattttatcattcattgtttaacaaattattactcactttttaatgcaaagagaat |
3868136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 205 - 298
Target Start/End: Original strand, 3878040 - 3878134
Alignment:
| Q |
205 |
ttaatagtaaatatacatgtcc-tgtgagctcagctcagttgataagcacatgcattattatagcctcaaaatgtttacaactaccatcttttct |
298 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3878040 |
ttaatagtaaatacacatgtccctgtaagctcagctcagttgataaggacatgcattattatagcgtcaaaatgtttacaactaccatcttttct |
3878134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University