View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_23 (Length: 249)
Name: NF10925_low_23
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 106 - 232
Target Start/End: Complemental strand, 37554371 - 37554245
Alignment:
| Q |
106 |
aaagggacatgaattcaaatttaatcctcctctgtgtggtgttcccatattatttatcaacttcaacaataaaaataattgttggggccaactttgtcgc |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554371 |
aaagggacatgaattaaaatttaatcctcctctgtgtggtgttcgtatattatttatcaacttcaacaataaaaataattgttggggccaactttgtcgc |
37554272 |
T |
 |
| Q |
206 |
taataaaaatagagctcgaacgttctt |
232 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
37554271 |
taataaaaacagagctcgaacgttctt |
37554245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University