View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_29 (Length: 239)
Name: NF10925_low_29
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 182
Target Start/End: Original strand, 26410003 - 26410172
Alignment:
| Q |
13 |
agcagagattcaggagagaagatggtgagtggttgttttgaacatttattttggagagagaaattaagaacaataaatttctgtttatattttgggtaac |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26410003 |
agcagaaattcaggagagaagatggtgagtggttgttttgaacatttattttggagagagaaatgaagaacaataaatttctgtttatattttgggtaac |
26410102 |
T |
 |
| Q |
113 |
tcatatgacttggttaatttaatggccgaagatgttgagaagcctttacttctattatagagtgttaaat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
26410103 |
tcatatgacttggttaatttaatggccgaagatgttgataagcctttagttctattctagagtgttaaat |
26410172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University