View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_33 (Length: 232)
Name: NF10925_low_33
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 49 - 223
Target Start/End: Complemental strand, 27956597 - 27956411
Alignment:
| Q |
49 |
tcgtgactactctaaaacacttttcatgaatttgaagaaatctttcacacttaatagtattattga------------tataagaaaataatgacaaaca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27956597 |
tcgtgactactctaaaacacttttcatgaatttgaagaaatctttcacacttaatagtattattgacataagaattgttataagaaaataatgacaaaca |
27956498 |
T |
|
| Q |
137 |
atgtattgaaccatcatatttatatcgtatcatatacaatttcaagtttataactatgaatcagccgtaagttatgaacatgtatct |
223 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27956497 |
atgtattgaagcatcatatttatatcgtatcatatacaatttcaagtttataactatgaatcagccgtaagttatgaacatgtatct |
27956411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University