View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10925_low_35 (Length: 225)

Name: NF10925_low_35
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10925_low_35
NF10925_low_35
[»] chr8 (1 HSPs)
chr8 (1-225)||(38096507-38096731)


Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 38096507 - 38096731
Alignment:
1 caggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgtgtaacgg 100  Q
    ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38096507 caggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgtgtaacgg 38096606  T
101 agaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgcttttcaagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38096607 agaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgcttttcaagc 38096706  T
201 tgaacctgtgctcaagaaatctaat 225  Q
    |||||||||||||||||||||||||    
38096707 tgaacctgtgctcaagaaatctaat 38096731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University