View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10925_low_36 (Length: 219)
Name: NF10925_low_36
Description: NF10925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10925_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 14658646 - 14658826
Alignment:
| Q |
13 |
agaagcaaagggcacatattcgatgatcatagcactaagttacttctgacctaattgatattccttttagctaaaaaccattatgtatgtttataaattt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
14658646 |
agaaacaaagggcacatattcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcattatgtatgcttataaattt |
14658745 |
T |
 |
| Q |
113 |
gattttacatgatcttgattctacaaaattgatttcagtgtaaatacatttacgttgctgctggttactcttgggtcacat |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
14658746 |
gattttgcatgatcttgattctacaaaattgatttcagtataaatacatttacattgttgctggttactcttgggtcacat |
14658826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University