View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1092_low_7 (Length: 294)
Name: NF1092_low_7
Description: NF1092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1092_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 176 - 237
Target Start/End: Complemental strand, 36422096 - 36422035
Alignment:
| Q |
176 |
ccacgcacgatagaagtaaagagatctgtcttctgatttgaattacacaagttgtgtctgtg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36422096 |
ccacgcacgatagaagtaaagagatctgtcttctgaattgaattacacaagttgtgtctgtg |
36422035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 61 - 104
Target Start/End: Complemental strand, 36422217 - 36422174
Alignment:
| Q |
61 |
agaaagaaagagagtgaaaatgtaagtaaattaaattaggatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422217 |
agaaagaaagagagtgaaaatgtaagtaaattaaattaggatta |
36422174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University