View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10930_low_5 (Length: 294)
Name: NF10930_low_5
Description: NF10930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10930_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 24263084 - 24263351
Alignment:
| Q |
16 |
tttattacatcatttgaacacaaaaacgtgaccggttttagagaataccacgatggaagaccaaggggtcctctttggagaggaaagaaactcattggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24263084 |
tttattacatcatttgaacacaaaaacgtgactggttttagagaataccacgatggaagaccaaggggtcctctttggagaggaaagaagctcattggta |
24263183 |
T |
|
| Q |
116 |
aagaagctctttatgtgatttctgggttgaaaaggtttaaagatgacgaagaaaagcttattaagttcatcaaaactcatgttttaaggttattgaagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24263184 |
aagaagctctttatgtgatttctgggttgaaaaggtttaaagatgacgaagaaaagcttcctaagttcatcacaactcatgttttaaggttattgaagat |
24263283 |
T |
|
| Q |
216 |
ggatttgattgctgttctcactgaacttgagcgacaacaggaagtttctctcgctctcaaggtttctt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263284 |
ggatttgattgctgttctcactgaacttgagcgacaacaggaagtttctctcgctctcaaggtttctt |
24263351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University