View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10930_low_7 (Length: 240)
Name: NF10930_low_7
Description: NF10930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10930_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 82 - 230
Target Start/End: Original strand, 41671979 - 41672124
Alignment:
| Q |
82 |
tatcttgaaattgcattgaaagtttgaggttagttttatcaagtggtgaaaagattttgcagatgatattcatgcttttttgaattaaatcaaataagtt |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41671979 |
tatcttgaaattccattgaaagtttgaggttagttttatcaagtggtgaaaagattttgcagatgatattcatgcttttttgaattaaatcaaataagtt |
41672078 |
T |
 |
| Q |
182 |
cgtctattnnnnnnnngagttaagagttgtttaaaggtttaatgatgtc |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41672079 |
cgtctatt---aaaaagagttaagagttgtttaaaggtttaatgatgtc |
41672124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 6 - 83
Target Start/End: Original strand, 41671872 - 41671949
Alignment:
| Q |
6 |
gagaagcaaaggtgctttggattgggcatatgcctctggaatgacaagggtgtccttgaaaatctcccaccattttta |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41671872 |
gagaatcaaaggtgctttggattgggcatatgcctctggaatgacaagggtgtccttgaaaatctcccaccattttta |
41671949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University