View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10931_high_14 (Length: 314)
Name: NF10931_high_14
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10931_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 30654146 - 30654067
Alignment:
| Q |
96 |
agtcgagattccaaagcagatgcagaaaaactagacataattgtatcgaaaatctcagcatagactcccaagaagccatc |
175 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30654146 |
agtcgagattgcgcagcagaggcagaaaaactagacagaattgtatcgaaaatctcagcatagactcccaacaagccatc |
30654067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 232 - 298
Target Start/End: Complemental strand, 10868817 - 10868751
Alignment:
| Q |
232 |
ttatagttctaatcacataactcacaaaattgaagctggattatactacatatatatcatccctaca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| | |||||||| || ||||||| |
|
|
| T |
10868817 |
ttatagttctaatcacataactcacaaaactgaagctggattatattgcatatataccagccctaca |
10868751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University