View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10931_high_14 (Length: 314)

Name: NF10931_high_14
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10931_high_14
NF10931_high_14
[»] chr5 (2 HSPs)
chr5 (96-175)||(30654067-30654146)
chr5 (232-298)||(10868751-10868817)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 30654146 - 30654067
Alignment:
96 agtcgagattccaaagcagatgcagaaaaactagacataattgtatcgaaaatctcagcatagactcccaagaagccatc 175  Q
    |||||||||| |  |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||    
30654146 agtcgagattgcgcagcagaggcagaaaaactagacagaattgtatcgaaaatctcagcatagactcccaacaagccatc 30654067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 232 - 298
Target Start/End: Complemental strand, 10868817 - 10868751
Alignment:
232 ttatagttctaatcacataactcacaaaattgaagctggattatactacatatatatcatccctaca 298  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||| || |||||||    
10868817 ttatagttctaatcacataactcacaaaactgaagctggattatattgcatatataccagccctaca 10868751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University