View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10931_high_23 (Length: 213)

Name: NF10931_high_23
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10931_high_23
NF10931_high_23
[»] chr2 (1 HSPs)
chr2 (8-195)||(2172340-2172527)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 2172340 - 2172527
Alignment:
8 gagagagaagaacacacttaggtgaattctaccttgctctgcatactttgcttcatctagctcaaacttgtcattgacaatagcagatatgttgtacttt 107  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2172340 gagagagaaaaacacacttaggtgaattctaccttgctctgcatactttgcttcatctagctcaaacttgtcattgacaatagcagatatgttgtacttt 2172439  T
108 tgaccttgagcagtgaacaaatgagaggagaaaagggggaacgttttagcattgtacgcatttaggccccaatatgcaatgggaacca 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2172440 tgaccttgagcagtgaacaaatgagaggagaaaagggggaacgttttagcattgtacgcatttaggccccaatatgcaatgggaacca 2172527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University