View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10931_high_23 (Length: 213)
Name: NF10931_high_23
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10931_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 2172340 - 2172527
Alignment:
| Q |
8 |
gagagagaagaacacacttaggtgaattctaccttgctctgcatactttgcttcatctagctcaaacttgtcattgacaatagcagatatgttgtacttt |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172340 |
gagagagaaaaacacacttaggtgaattctaccttgctctgcatactttgcttcatctagctcaaacttgtcattgacaatagcagatatgttgtacttt |
2172439 |
T |
|
| Q |
108 |
tgaccttgagcagtgaacaaatgagaggagaaaagggggaacgttttagcattgtacgcatttaggccccaatatgcaatgggaacca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172440 |
tgaccttgagcagtgaacaaatgagaggagaaaagggggaacgttttagcattgtacgcatttaggccccaatatgcaatgggaacca |
2172527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University