View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10931_high_24 (Length: 207)
Name: NF10931_high_24
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10931_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 39845354 - 39845494
Alignment:
| Q |
1 |
cgtatctttgaattttctaatttgctacaaagtacaatctcccctttgataagccatagaggttgtttttgagttaagcctcaccgtcttcactatttgg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39845354 |
cgtatctttgaattttctaatttactactaagtacaatctcccctttgataagccatagaggttgtttttgagttaagcctcaccgtcttcactatttgg |
39845453 |
T |
|
| Q |
101 |
caacagctgatcgttgagtgcacttcaaattgaattttcta |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39845454 |
caacagctgatcgttgagtgcacttcaaattgaattttcta |
39845494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University