View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10931_high_25 (Length: 202)
Name: NF10931_high_25
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10931_high_25 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 2172373 - 2172172
Alignment:
| Q |
1 |
aggtagaattcacctaagtgtgtttttctctctcacttatggctttggatttgcaaccatagcatccacccttacacatgttgcttgcttctatggaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172373 |
aggtagaattcacctaagtgtgtttttctctctcacttatggctttggatttgcaaccatagcatccacccttacacatgttgcttgcttctatggaagg |
2172274 |
T |
 |
| Q |
101 |
taatacagttgtccaaattatttagcattggtgtttaatttctaacttaatttaatatgatgaatgttctcaatatcatattgcttctgctgctgccgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172273 |
taatacagttgtccaaattatttagcattggtgtttaatttctaacttaatttaatatgatgaatgttctcaatatcatattgcttctgctgctgccgat |
2172174 |
T |
 |
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
2172173 |
tc |
2172172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 37 - 102
Target Start/End: Original strand, 36902089 - 36902154
Alignment:
| Q |
37 |
ttatggctttggatttgcaaccatagcatccacccttacacatgttgcttgcttctatggaaggta |
102 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36902089 |
ttatggatttggattcgccaccatagcatccaccgttacacatgttgcttgcttctatggaaggta |
36902154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University