View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10931_low_27 (Length: 207)

Name: NF10931_low_27
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10931_low_27
NF10931_low_27
[»] chr5 (1 HSPs)
chr5 (1-141)||(39845354-39845494)


Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 39845354 - 39845494
Alignment:
1 cgtatctttgaattttctaatttgctacaaagtacaatctcccctttgataagccatagaggttgtttttgagttaagcctcaccgtcttcactatttgg 100  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39845354 cgtatctttgaattttctaatttactactaagtacaatctcccctttgataagccatagaggttgtttttgagttaagcctcaccgtcttcactatttgg 39845453  T
101 caacagctgatcgttgagtgcacttcaaattgaattttcta 141  Q
    |||||||||||||||||||||||||||||||||||||||||    
39845454 caacagctgatcgttgagtgcacttcaaattgaattttcta 39845494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University