View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10931_low_8 (Length: 423)
Name: NF10931_low_8
Description: NF10931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10931_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 4717254 - 4717469
Alignment:
| Q |
1 |
ctgcactgttcacggcaaattatgtcaaattctcttcccctctgtctcccgacacctcatgaagcataaatctccattcatcaatctaatcttcatataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4717254 |
ctgcactgttcacggcaaattatgtcaaattctcttcccctctgtctcccgacacctcatgaagcataaatctccattcatcaatctaaccttcatataa |
4717353 |
T |
 |
| Q |
101 |
tttcttccattttcttctttgttgttagattgttaatttaggtttagtttgttcattgtgtggtgttagaacccacctaaaaaatcgatttcaatgtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4717354 |
tttcttccattttcttctttgttgttagattgttaatttaggtttagtttgttgattgtgtgctgttagaacccacctaaaaaatagatttcaatgtttt |
4717453 |
T |
 |
| Q |
201 |
gtaacttaaatatgaa |
216 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
4717454 |
ggaacttaaatatgaa |
4717469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University