View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10932_high_13 (Length: 299)
Name: NF10932_high_13
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10932_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 56 - 269
Target Start/End: Complemental strand, 38826335 - 38826122
Alignment:
| Q |
56 |
gtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctcttggttaagcaaatggaatttgcacctacatttgcacttcgattatcagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38826335 |
gtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctcttggttaagcaaatggaatttgcacctacatttgcactccgattatcagt |
38826236 |
T |
 |
| Q |
156 |
tcgcacactatatgttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38826235 |
tcgcacactatatgttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttg |
38826136 |
T |
 |
| Q |
256 |
accatgctcattgc |
269 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
38826135 |
accatgttcattgc |
38826122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University