View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10932_high_24 (Length: 244)
Name: NF10932_high_24
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10932_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 111 - 238
Target Start/End: Complemental strand, 13712665 - 13712538
Alignment:
| Q |
111 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttctactcacttaaattgtaaggagctagtcaatttagtcctta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13712665 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttctactcacttaaattgtaaggagctagtcaatttagtcctta |
13712566 |
T |
|
| Q |
211 |
agttctagtacgttttaagttcatctca |
238 |
Q |
| |
|
|||||||||| |||||||||| |||||| |
|
|
| T |
13712565 |
agttctagtatgttttaagtttatctca |
13712538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 13712935 - 13712852
Alignment:
| Q |
18 |
gtttcattgttctattaatcttcctttgctcaaaaccctttatctatcttcagttcaatctgaagatatgattagatttcatgaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13712935 |
gtttcattgttctattaatcttcctttgctcaaaacccgttatctatcttcagttcaatttgaagatatga-aagatttcatgaa |
13712852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University