View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10932_low_17 (Length: 269)
Name: NF10932_low_17
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10932_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 5337665 - 5337905
Alignment:
| Q |
16 |
gcttcttcttcatcatcttctgcttctgtggttttgcaactggacatgcactgtcatggatgcaccaagaagatcctaagaactgttcaccgtttcgatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337665 |
gcttcttcttcatcatcttctgcttctgtggttttgcaactggacatgcactgtcatggatgcaccaagaagatcctaagaactgttcaccgtttcgatg |
5337764 |
T |
|
| Q |
116 |
gtaccattactataacttttctatatttcggaattttggatattacttttttaaattgagaagcgaaactaccaagacagccttgtttaacccaaacagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5337765 |
gtaccattactataacttttctatattttggaattttggatattaattttttaaattgagaagcgaaactaccaagacagccttgtttaacccaaattgg |
5337864 |
T |
|
| Q |
216 |
catcaaacccttttcaagagctttaaaattgatccatgttc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337865 |
catcaaacccttttcaagagctttaaaattgatccatgttc |
5337905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University